Figures
↓ Figure 1. Increased rate of pyroptosis in HF patients. (a–c) Expression of NRF-1, GSDMD and CASP1 in HF patients compared to healthy controls in the GSE46224, GSE141910 and GSE135055 datasets. (d, e) Expression of NRF-1 in HF samples compared to healthy controls in the GSE198945 and GSE230638 datasets. *P < 0.05, **P < 0.01, ****P < 0.0001. CASP1: caspase 1; GSDMD: gasdermin D; HF: heart failure; NF: normal cardiac function; NRF-1: nuclear respiratory factor-1.

↓ Figure 2. NRF-1 is negatively correlated with pyroptosis in HF patients. (a) Representative images of echocardiography in HF patients and NF controls. (b–g) Serum NT-proBNP, IL-18, IL-1β, NRF-1, GSDMD and caspase-1 level in HF patients (n = 15) and NF controls (n = 10). *P < 0.05, **P < 0.01, ***P < 0.001. GSDMD: gasdermin D; HF: heart failure; IL: interleukin; NF: normal cardiac function; NRF-1: nuclear respiratory factor-1; NT-proBNP: N-terminal pro-B-type natriuretic peptide.

↓ Figure 3. NRF-1 is negatively correlated with pyroptosis in HF rats. (a) Expression of Nrf-1 in HF samples compared to healthy controls in the GSE284743 datasets. (b) Schematic diagram of rat heart failure model. (c) Quantification of key ultrasound indicators including left ventricular ejection fraction (LVEF), left ventricular fractional shortening (LVFS), left ventricular internal dimension at end-diastole (LVIDd) and left ventricular internal dimension at end-systole (LVIDs) in HF rats (n = 6), sham rats (n = 6) and control rats (n = 6) for 4 weeks after successful modelling. (d) Body weight changes in HF rats (n = 6), sham rats (n = 6) and control rats (n = 6) 4 weeks after LAD ligation surgery. (e) Ratio of heart weight and body weight of HF rats (n = 6), sham rats (n = 6) and control rats (n = 6) at the fourth week after LAD ligation surgery. (f) Western blots of IL-18, IL-1β, NRF-1, GSDMD and caspase-1 level in HF rats (n = 6), sham rats (n = 6) and control rats (n = 6). *P < 0.05, **P < 0.01, ****P < 0.0001. Ctrl: control; HF: heart failure; IL: interleukin; LAD: left anterior descending; NF: normal cardiac function; NRF-1: nuclear respiratory factor-1; GAPDH: glyceraldehyde-3-phosphate dehydrogenase; GSDMD: gasdermin D; HW: heart weight; BW: body weight.

↓ Figure 4. NRF-1 inhibits H9C2 hypoxia-induced apoptosis and pyroptosis. (a, b) Construction and validation of H9C2 overexpressing NRF-1 cell line (pCDH-NRF1) and inhibited cell line (sh-NRF-1) (× 200, scale bars = 100 µm). (c, d) Effects of NRF-1 on the proliferation of H9C2 cells under normoxia and hypoxia for 24 h. (e, f) Effects of NRF-1 on the pyroptosis of H9C2 cells under hypoxia for 24 h (n = 3). *P < 0.05, **P < 0.01, ***P < 0.001. NRF-1: nuclear respiratory factor-1; BF: bright field; GFP: green fluorescent protein; FITC: fluorescein isothiocyanate.

↓ Figure 5. NRF-1 inhibits the expression of pyroptosis core molecules. (a) Effect of NRF-1 on RNA level expression of GSDMD and CASP1 under normoxia and hypoxia in H9C2. (b) Effect of NRF-1 on protein level expression of GSDMD, caspase-1, IL-18 and IL-1β under normoxia and hypoxia in H9C2. (c) Effect of NRF-1 on IL-18 and IL-1β expression in H9C2 cell culture supernatants under normoxia and hypoxia. (d) The figure presents Adriamycin (doxorubicin (DOX))-induced damage in H9C2 cells (× 400, scale bars = 20 µm). (e) Effect of NRF-1 on RNA level expression of GSDMD and CASP1 under DOX-induced H9C2. (f) Effect of NRF-1 on IL-18 and IL-1β expression in cell culture supernatants under DOX-induced H9C2. (g) Effect of NRF-1 on protein level expression of GSDMD, caspase-1, IL-18 and IL-1β under DOX-induced H9C2 (n = 3). *P < 0.05, **P < 0.01, ***P < 0.001. CASP1: caspase 1; GSDMD: gasdermin D; NRF-1: nuclear respiratory factor-1; Ctrl: control; GAPDH: glyceraldehyde-3-phosphate dehydrogenase.

↓ Figure 6. NRF-1 is temporally active in regulating pyroptosis in heart failure. (a) RNA level expression of NRF-1, GSDMD and CASP1 in H9C2 cells during 4 h of hypoxia (n = 3). (b) IL-18 and IL-1β expression in cell culture supernatants in H9C2 cells during 4 h of hypoxia (n = 3). (c) Serum NRF-1 expression in patients of HF-H (n = 15), HF-L (n = 15) and NF (n = 15). **P < 0.01, ***P < 0.001. Patients in New York Heart Association (NYHA) functional class I were classified as HF-L (HF-low), whereas those in class IV were classified as HF-H (HF-high). CASP1: caspase 1; GSDMD: gasdermin D; NRF-1: nuclear respiratory factor-1; HF: heart failure; NF: normal cardiac function.

Table
↓ Table 1. The Primer Sequences of the Relevant Genes
| Gene | Primer sequence (5'–3') |
|---|
| F: forward primer; R: reverse primer. |
| NRF1 | F: TCTGCTGTGGCTGATGGAGAGG |
| R: GATGCTTGCGTCGTCTGGATGG |
| GSDMD | F: ATGAGGTGCCTCCACAACTTCC |
| R: CCAGTTCCTTGGAGATGGTCTC |
| CASP1 | F: GACCGAGTGGTTCCCTCAAG |
| R: GACGTGTACGAGTGGGTGTT |
| GAPDH | F: ATGGCACAGTCAAGGCTGAGA |
| R: CGCTCCTGGAAGATGGTGAT |